# Synthetic Systems

> --

- Skill: `neuralblitz/synthetic-systems` (Agent Skill)
- Install (CLI): `npx skillmds@latest add neuralblitz/synthetic-systems`
- Raw SKILL.md: https://api.skillmd.com/api/skills/neuralblitz/synthetic-systems/raw
- Safety review: pending
- Works with: Claude Code, Claude.ai, OpenAI Codex
- Category: Coding & Dev Tools
- Author: NeuralBlitz (https://skillmd.com/u/neuralblitz)
- Updated: 2026-09-17
- Page: https://skillmd.com/skills/neuralblitz/synthetic-systems

---

--

## Systems Engineering in Biology

### Design-Build-Test-Learn (DBTL) Cycle

The DBTL cycle is the core framework for synthetic biology:

```python
# DBTL workflow structure
class DBTLCycle:
    def __init__(self):
        self.design = DesignPhase()
        self.build = BuildPhase()
        self.test = TestPhase()
        self.learn = LearnPhase()
    
    def run_cycle(self, objective, iterations=10):
        """
        Execute DBTL cycles until objective is met.
        """
        results = []
        
        for i in range(iterations):
            print(f"\n=== Cycle {i+1} ===")
            
            # 1. Design
            design = self.design.create_design(objective)
            print(f"Design: {design['parts']}")
            
            # 2. Build
            construct = self.build.assemble(design)
            print(f"Built: {construct['name']}")
            
            # 3. Test
            measurements = self.test.measure(construct)
            print(f"Measurements: {measurements}")
            
            # 4. Learn
            insights = self.learn.analyze(measurements, design)
            print(f"Insights: {insights}")
            
            results.append({
                'cycle': i,
                'design': design,
                'measurements': measurements,
                'insights': insights
            })
            
            # Update objective based on learning
            objective = self.update_objective(objective, insights)
        
        return results
    
    def update_objective(self, objective, insights):
        """Refine objective based on cycle insights"""
        # Modify design parameters based on what was learned
        return objective

# Design phase components
design_phase = {
    'parts_selection': 'Choose genetic parts (promoters, RBS, CDS, terminators)',
    'circuit_topology': 'Design circuit architecture',
    'parameter_estimation': 'Set expected values for parameters',
    'simulation': 'Model expected behavior',
    'safety_check': 'Verify biosafety considerations'
}
```

### Abstraction Levels in Synthetic Biology

| Level | Description | Examples |
|-------|-------------|----------|
| **DNA** | Sequence of nucleotides | A, T, G, C |
| **Part** | Functional unit | Promoter, RBS, CDS, terminator |
| **Device** | Combination of parts | AND gate, oscillator |
| **System** | Multiple devices | Toggle switch, repressilator |
| **Chassis** | Host organism | E. coli, S. cerevisiae, mammalian cells |

```python
# Standard biological parts
class GeneticPart:
    def __init__(self, name, part_type, sequence):
        self.name = name
        self.part_type = part_type  # promoter, rbs, cds, terminator
        self.sequence = sequence
    
    def get_sequence(self):
        return self.sequence

# Part types with properties
part_registry = {
    'promoter': {
        'function': 'RNA polymerase binding site',
        'types': ['constitutive', 'inducible', 'repressible'],
        'examples': ['BBa_J23100', 'BBa_R0040', 'BBa_T7']
    },
    'rbs': {
        'function': 'Ribosome binding site',
        'properties': ['strength', 'spacing'],
        'examples': ['BBa_B0034', 'BBa_B0030']
    },
    'cds': {
        'function': 'Coding sequence',
        'features': ['start_codon', 'stop_codon', 'codon_optimization']
    },
    'terminator': {
        'function': 'Transcription termination',
        'types': ['rho-dependent', 'rho-independent']
    }
}
```

-----

## Mathematical Modeling of Gene Circuits

### Ordinary Differential Equation (ODE) Models

```python
import numpy as np
from scipy.integrate import odeint

# Basic gene expression model
def gene_expression_model(y, t, params):
    """
    Simple model of gene expression.
    y = [mRNA, Protein]
    params = [k_tx, k_tl, d_m, d_p]
    """
    mRNA, protein = y
    k_tx, k_tl, d_m, d_p = params
    
    # Transcription: mRNA production
    dm_dt = k_tx - d_m * mRNA
    
    # Translation: Protein production from mRNA
    dp_dt = k_tl * mRNA - d_p * protein
    
    return [dm_dt, dp_dt]

# Simulate
def simulate_gene_expression(t_max=100, params=None):
    if params is None:
        params = [1.0, 0.5, 0.1, 0.05]  # k_tx, k_tl, d_m, d_p
    
    t = np.linspace(0, t_max, 1000)
    y0 = [0, 0]  # Initial conditions: [mRNA, protein]
    
    solution = odeint(gene_expression_model, y0, t, args=(params,))
    
    return t, solution

# Example: Repressible gene circuit (negative feedback)
def repressible_circuit(y, t, params):
    """
    Repressible circuit with negative feedback.
    """
    R, G, P = y  # Repressor, GFP, Protein
    k_prod_R, k_deg_R, k_prod_G, k_deg_G, k_prod_P, k_deg_P = params
    K_d = 10  # Dissociation constant
    
    # Hill function repression
    repression = K_d**n / (K_d**n + P**n)
    
    dR_dt = k_prod_R * repression - k_deg_R * R
    dG_dt = k_prod_G - k_deg_G * G
    dP_dt = k_prod_P * G - k_deg_P * P
    
    return [dR_dt, dG_dt, dP_dt]
```

### Stochastic Modeling

```python
# Stochastic simulation (Gillespie algorithm)
def gillespie_simulation(stoichiometry, propensity_fn, initial_state, t_max):
    """
    Gillespie algorithm for stochastic simulation.
    """
    state = np.array(initial_state)
    t = 0
    trajectory = [state.copy()]
    times = [t]
    
    while t < t_max:
        # Calculate propensities
        a = propensity_fn(state)
        a0 = sum(a)
        
        if a0 == 0:
            break
        
        # Time to next reaction
        tau = np.random.exponential(1.0 / a0)
        
        # Select reaction
        r = np.random.choice(len(a), p=a/a0)
        
        # Update state
        state = state + stoichiometry[r]
        t += tau
        
        trajectory.append(state.copy())
        times.append(t)
    
    return np.array(times), np.array(trajectory)

# Example: Simple gene expression (constitutive)
def constitutive_expression_stochastic():
    stoichiometry = [
        [1, 0],   # Transcription: +1 mRNA
        [-1, 0],  # mRNA degradation
        [0, 1],   # Translation: +1 protein
        [0, -1]   # Protein degradation
    ]
    
    def propensity(state, params):
        k_tx, k_deg_m, k_tl, k_deg_p = params
        mRNA, protein = state
        return [
            k_tx,                    # Transcription
            k_deg_m * max(mRNA, 0),  # mRNA decay
            k_tl * max(mRNA, 0),     # Translation
            k_deg_p * max(protein, 0)  # Protein decay
        ]
    
    params = [1.0, 0.1, 0.5, 0.05]
    initial = [0, 0]
    
    return gillespie_simulation(stoichiometry, propensity, initial, 100)
```

### Boolean Network Models

```python
# Boolean network for gene regulation
class BooleanNetwork:
    def __init__(self, genes, update_functions):
        self.genes = genes
        self.update_fn = update_functions
        self.state = {g: 0 for g in genes}
    
    def update(self):
        """Synchronous Boolean update"""
        new_state = {}
        for gene in self.genes:
            new_state[gene] = self.update_fn[gene](self.state)
        self.state = new_state
        return self.state
    
    def simulate(self, steps):
        """Run simulation"""
        trajectory = [self.state.copy()]
        for _ in range(steps):
            self.update()
            trajectory.append(self.state.copy())
        return trajectory

# Example: Toggle switch
toggle_switch = BooleanNetwork(
    genes=['A', 'B'],
    update_functions={
        'A': lambda s: 1 - s['B'],  # A is ON when B is OFF
        'B': lambda s: 1 - s['A']   # B is ON when A is OFF
    }
)
```

-----

## DNA Assembly Methods

### Common Assembly Strategies

```python
# Golden Gate Assembly (Type IIS restriction)
class GoldenGateAssembly:
    def __init__(self, overhangs):
        self.overhangs = overhangs  # Dictionary of overhangs
    
    def design_primers(self, part, destination_overhang):
        """
        Design primers with overhangs.
        """
        forward = part.sequence[:20] + self.overhangs[destination_overhang]
        reverse = self.reverse_complement(
            part.sequence[-20:] + self.overhangs[destination_overhang]
        )
        return {'forward': forward, 'reverse': reverse}
    
    def assemble(self, parts):
        """
        Combine parts in correct order.
        """
        # All parts have compatible overhangs
        return ''.join([p.sequence for p in parts])

# Gibson Assembly (overlap-based)
class GibsonAssembly:
    def __init__(self, overlap_length=20):
        self.overlap_length = overlap_length
    
    def generate_overlaps(self, part1_seq, part2_seq):
        """
        Generate overlapping regions for Gibson.
        """
        overlap = part1_seq[-self.overlap_length:]
        return overlap
    
    def design_primers_for_ Gibson(self, part, direction):
        """
        Design primers with overlaps for Gibson.
        """
        # Forward primer adds overlap to next part
        # Reverse primer adds overlap to previous part
        pass

# BioBricks Assembly (Standard assembly)
class BioBricksAssembly:
    def __init__(self):
        self.prefix = 'GAATTCGCGGCCGCTTCTAG'  # EcoRI-XbaI
        self.suffix = 'TACTAGTAGCGGCCGCTGCAG'  # SpeI-PstI
    
    def prefix_parts(self, part):
        """Add prefix to part"""
        return self.prefix + part.sequence
    
    def suffix_parts(self, part):
        """Add suffix to part"""
        return part.sequence + self.suffix
```

### Part Design Principles

```python
# Codon optimization
def optimize_codon_usage(gene_sequence, organism='e_coli'):
    """
    Optimize codon usage for expression.
    """
    # Codon usage tables
    codon_usage = {
        'e_coli': {
            'TTT': 0.56, 'TTC': 0.54, 'TTA': 0.14, 'TTG': 0.14,
            'TCT': 0.18, 'TCC': 0.15, 'TCA': 0.15, 'TCG': 0.14,
            # ... complete table
        }
    }
    
    # Replace rare codons with common ones
    optimized = gene_sequence  # Simplified
    return optimized

# RBS Calculator
def calculate_rbs_strength(sequence, model='shine_dalgarno'):
    """
    Calculate RBS strength based on sequence.
    """
    # Shine-Dalgarno: AGGAGGT
    sd_sequence = 'AGGAGGT'
    
    # Calculate binding energy
    # This would use thermodynamic model
    return 0.5  # Placeholder
```

-----

## Gene Circuit Design

### Logic Gates in Biology

```python
# Genetic AND gate
class ANDGate:
    """
    Two-input AND gate using repressors.
    A and B must both be present to activate output.
    """
    def __init__(self):
        self.inputs = ['A', 'B']
        self.output = 'C'
    
    def design_parts(self):
        return {
            'A_promoter': 'repressible_by_A',
            'B_promoter': 'repressible_by_B',
            'C_promoter': 'requires_A_and_B'  # Activated by A and B
        }

# Genetic OR gate
class ORGate:
    """
    Two-input OR gate.
    Either A or B activates output.
    """
    def __init__(self):
        self.inputs = ['A', 'B']
        self.output = 'C'
    
    def design_parts(self):
        return {
            'C_promoter_A': 'activated_by_A',
            'C_promoter_B': 'activated_by_B'
        }

# NOT gate (repressor)
class NOTGate:
    """
    Single-input NOT gate.
    """
    def design_parts(self):
        return {
            'input_promoter': 'repressible',
            'output_promoter': 'constitutive',
            'repressor': 'protein that binds input_promoter'
        }

# Oscillator (Repressilator)
class Repressilator:
    """
    Three repressors in a ring.
    """
    def __init__(self):
        self.repressors = ['TetR', 'LacI', 'cI']
    
    def design(self):
        return {
            'promoter_1': 'repressed_by_cI',
            'promoter_2': 'repressed_by_TetR',
            'promoter_3': 'repressed_by_LacI'
        }
```

### Sensor Design

```python
# Biosensor design
class Biosensor:
    def __init__(self, target):
        self.target = target
        self.receptor = None
        self.reporter = None
    
    def design(self):
        if self.target == 'arsenic':
            return self.arsenic_sensor()
        elif self.target == 'tetracycline':
            return self.tet_sensor()
        else:
            return self.generic_sensor()
    
    def arsenic_sensor(self):
        """
        Arsenic-responsive biosensor using ArsR repressor.
        """
        return {
            'promoter': 'pArs',
            'receptor': 'ArsR',
            'reporter': 'GFP',
            'threshold': '10 ppb arsenic'
        }
    
    def tet_sensor(self):
        """
        Tetracycline-responsive sensor using TetR.
        """
        return {
            'promoter': 'pTet',
            'receptor': 'TetR',
            'reporter': 'mCherry',
            'inducer': 'aTc (anhydrotetracycline)'
        }
```

-----

## Metabolic Engineering

### Pathway Optimization

```python
# Metabolic pathway modeling
class MetabolicPathway:
    def __init__(self, metabolites, reactions):
        self.metabolites = metabolites
        self.reactions = reactions
        self.stoichiometry = {}
    
    def build_stoichiometry_matrix(self):
        """Build stoichiometry matrix for metabolic model."""
        n_metabolites = len(self.metabolites)
        n_reactions = len(self.reactions)
        
        S = np.zeros((n_metabolites, n_reactions))
        
        for j, rxn in enumerate(self.reactions):
            for metabolite, coeff in rxn['stoich'].items():
                i = self.metabolites.index(metabolite)
                S[i, j] = coeff
        
        return S

# Flux Balance Analysis
def flux_balance_analysis(stoichiometry, objective_reaction, bounds=None):
    """
    FBA optimization problem.
    """
    from scipy.optimize import linprog
    
    # Objective: maximize flux through objective reaction
    c = np.zeros(len(objective_reaction))
    c[objective_reaction] = -1  # Negative for minimization
    
    # Bounds on fluxes
    if bounds is None:
        bounds = [(-1000, 1000) for _ in range(stoichiometry.shape[1])]
    
    # Solve
    result = linprog(c, A_eq=stoichiometry, b_eq=np.zeros(stoichiometry.shape[0]),
                    bounds=bounds)
    
    return result.x
```

### Strain Engineering Strategies

| Strategy | Description | Application |
|----------|-------------|-------------|
| **Knockout** | Remove competing pathways | Increase product yield |
| **Knock-in** | Add new pathways | Produce novel compounds |
| **Overexpression** | Increase gene expression | Boost pathway flux |
| **Promoter swapping** | Tune expression levels | Balance pathway |
| **Codon optimization** | Improve translation | Increase protein yield |
| **Compartmentalization** | Separate pathways | Reduce toxicity |

-----

## CRISPR Systems

### CRISPR-Cas9 Design

```python
# gRNA design
def design_sgRNA(target_sequence, pam='NGG', on_target_score=True):
    """
    Design single guide RNA for CRISPR-Cas9.
    """
    gRNAs = []
    
    for i in range(len(target_sequence) - 22):
        # Find PAM sites
        potential_pam = target_sequence[i+20:i+22]
        
        if potential_pam == 'GG':  # NGG PAM
            protospacer = target_sequence[i:i+20]
            
            gRNA = {
                'protospacer': protospacer,
                'pam': target_sequence[i+20:i+23],
                'position': i,
                'strand': '+'
            }
            
            # Calculate on-target score (simplified)
            if on_target_score:
                gRNA['score'] = calculate_crispr_score(protospacer)
            
            gRNAs.append(gRNA)
    
    return gRNAs

def calculate_crispr_score(protospacer):
    """
    Simplified on-target scoring.
    Real scoring uses position weight matrices.
    """
    # GC content
    gc = (protospacer.count('G') + protospacer.count('C')) / len(protospacer)
    
    # Simple scoring
    if 0.4 < gc < 0.7:
        return 0.8
    else:
        return 0.5

# CRISPRa/CRISPRi
crispr_variants = {
    'Cas9': {
        'function': 'DNA cleavage',
        'application': 'Gene knockout'
    },
    'dCas9': {
        'function': 'DNA binding (no cleavage)',
        'application': 'CRISPRi (repression) or CRISPRa (activation)'
    },
    'Cas12a': {
        'function': 'DNA cleavage',
        'difference': 'Different PAM, staggered cut'
    },
    'Cas13': {
        'function': 'RNA cleavage',
        'application': 'RNA targeting, diagnostics'
    }
}
```

-----

## Design Tools and Resources

### Software Tools

| Tool | Purpose | URL |
|------|---------|-----|
| **SynBioHub** | Part registry | synbiohub.org |
| **Benchling** | Design platform | benchling.com |
| **SnapGene** | Sequence design | snapgene.com |
| **Tale Designer** | TALEN design | talendesign.org |
| **CHOPCHOP** | CRISPR guide design | chopchop.cbu.uib.no |
| **RBS Calculator** | RBS optimization | rbscalculator.org |
| **COPASI** | Modeling | copasi.org |
| **Cello** | Circuit design | celldesigner.org |

### Standards

| Standard | Description |
|----------|-------------|
| **SBOL** | Synthetic Biology Open Language |
| **SBOL Visual** | Visual notation standard |
| **GenBank** | Sequence format |
| **FASTA** | Sequence format |
| **SBML** | Model format |

-----

## Common Errors to Avoid

- **Ignoring context effects**: Genetic context affects part function
- **Not characterizing parts**: Always test individual parts
- **Over-engineering circuits**: Simpler is more robust
- **Neglecting host constraints**: Chassis matters
- **Forgetting burden**: Synthetic circuits compete for resources
- **Ignoring toxicity**: Some parts/products are toxic
- **Not iterating**: DBTL requires multiple cycles
- **Assuming orthogonality**: Parts may interact unexpectedly
- **Not considering escape**: Mutations can break circuits
- **Ignoring ethics**: Biosafety and biosecurity considerations