name: 'crispr-offtarget-predictor'
description: 'Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.'
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
CRISPR Off-Target Predictor
This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.
When to Use This Skill
Designing new CRISPR experiments.
Validating sgRNA specificity before synthesis.
Analyzing potential safety risks in gene editing protocols.
Core Capabilities
Mismatch Scoring: Calculates mismatch penalties for potential sites.
PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.
Workflow
Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
Analysis: Scans a reference library (mocked for this version) for similar sequences.
Output: List of potential off-targets with locations and risk scores.
Example Usage
User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."
1---2name: crispr-offtarget-predictor3description: <!--4---5<!--6# COPYRIGHT NOTICE7# This file is part of the "Universal Biomedical Skills" project.8# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>9# All Rights Reserved.10#11# This code is proprietary and confidential.12# Unauthorized copying of this file, via any medium is strictly prohibited.13#14# Provenance: Authenticated by MD BABU MIA1516-->1718---19name: 'crispr-offtarget-predictor'20description: 'Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.'21measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.22allowed-tools:23 - read_file24 - run_shell_command25---262728# CRISPR Off-Target Predictor2930This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.3132## When to Use This Skill3334* Designing new CRISPR experiments.35* Validating sgRNA specificity before synthesis.36* Analyzing potential safety risks in gene editing protocols.3738## Core Capabilities39401. **Mismatch Scoring**: Calculates mismatch penalties for potential sites.412. **PAM Validation**: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.423. **Risk Assessment**: Categorizes off-targets as Low, Medium, or High risk.4344## Workflow45461. **Input**: sgRNA sequence (20nt) and PAM (e.g., NGG).472. **Analysis**: Scans a reference library (mocked for this version) for similar sequences.483. **Output**: List of potential off-targets with locations and risk scores.4950## Example Usage5152**User**: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."5354**Agent Action**:55```bash56python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG57```585960<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->
Run npx skillmds@latest add biotender-max/crispr-offtarget-predictor in your terminal (requires Node.js), paste this page's agent-chat prompt into Claude, Cursor, or any MCP-connected agent, or download the SKILL.md file and copy it into your agent's skills directory.
<!-- It is listed under Coding & Dev Tools on SkillMD.
This skill has not completed SkillMD's automated safety review yet. SkillMD never runs a skill's scripts for you; review the SKILL.md before installing.
This skill is tagged as working with Claude Code, Claude.ai, OpenAI Codex. SKILL.md is an open format, so most agents that read a skills directory can load it too.
Yes. Installing skills from SkillMD is free, and the skill stays under its author's original license.
BioTender-max (@biotender-max) published this skill. Their other Agent Skills are listed on their SkillMD profile.
BioTender-max