ffsshhttiikk Molecular Biology
What I Do
Molecular biology investigates the molecular mechanisms underlying cellular processes. I cover DNA replication, transcription, translation, gene regulation, recombinant DNA technology, PCR, sequencing, and molecular cloning techniques. I help design experiments, analyze genetic sequences, and understand gene expression patterns.
When to Use Me
- Designing PCR primers and cloning strategies
- Analyzing DNA and protein sequences
- Understanding gene expression regulation
- Working with recombinant DNA and expression vectors
- Interpreting sequencing data and variants
- Studying epigenetic modifications
- Developing molecular assays and diagnostics
Core Concepts
- Central Dogma: DNA → RNA → Protein flow of genetic information
- DNA Structure: Double helix, base pairing, replication mechanisms
- Transcription: RNA polymerase, promoters, enhancers, post-transcriptional modifications
- Translation: Ribosomes, tRNA, genetic code, protein synthesis
- Gene Regulation: Promoters, operators, transcription factors, epigenetic control
- Recombinant DNA: Restriction enzymes, ligases, vectors, transformation
- PCR: Primers, cycling conditions, qPCR, RT-PCR applications
- Sequencing: Sanger, NGS, variant calling, sequence alignment
- RNA Biology: miRNA, siRNA, lncRNA, RNA interference
- Epigenetics: DNA methylation, histone modification, chromatin remodeling
Code Examples
import numpy as np
from typing import List, Dict, Tuple
class DNAAnalysis:
def __init__(self, sequence: str):
self.sequence = sequence.upper().replace(' ', '').replace('\n', '')
def transcribe(self) -> str:
complement = {'A': 'U', 'T': 'A', 'G': 'C', 'C': 'G'}
return ''.join(complement.get(base, 'N') for base in self.sequence)
def reverse_transcribe(self) -> str:
return self.sequence[::-1]
def translate(self, frame: int = 0) -> str:
codon_table = {
'TTT': 'F', 'TTC': 'F', 'TTA': 'L', 'TTG': 'L',
'CTT': 'L', 'CTC': 'L', 'CTA': 'L', 'CTG': 'L',
'ATT': 'I', 'ATC': 'I', 'ATA': 'I', 'ATG': 'M',
'GTT': 'V', 'GTC': 'V', 'GTA': 'V', 'GTG': 'V',
'TCT': 'S', 'TCC': 'S', 'TCA': 'S', 'TCG': 'S',
'CCT': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P',
'ACT': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T',
'GCT': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A',
'TAT': 'Y', 'TAC': 'Y', 'TAA': '*', 'TAG': '*',
'CAT': 'H', 'CAC': 'H', 'CAA': 'Q', 'CAG': 'Q',
'AAT': 'N', 'AAC': 'N', 'AAA': 'K', 'AAG': 'K',
'GAT': 'D', 'GAC': 'D', 'GAA': 'E', 'GAG': 'E',
'TGT': 'C', 'TGC': 'C', 'TGA': '*', 'TGG': 'W',
'CGT': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R',
'AGT': 'S', 'AGC': 'S', 'AGA': 'R', 'AGG': 'R',
'GGT': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G'
}
protein = ""
for i in range(frame, len(self.sequence) - 2, 3):
codon = self.sequence[i:i+3]
protein += codon_table.get(codon, 'X')
return protein
def reverse_complement(self) -> str:
complement = {'A': 'T', 'T': 'A', 'G': 'C', 'C': 'G'}
return ''.join(complement.get(base, 'N') for base in self.sequence[::-1])
def gc_content(self) -> float:
gc = sum(1 for base in self.sequence if base in 'GC')
return gc / len(self.sequence) * 100 if self.sequence else 0
def find_restriction_sites(self) -> Dict[str, List[int]]:
enzymes = {
'EcoRI': 'GAATTC',
'BamHI': 'GGATCC',
'HindIII': 'AAGCTT',
'NotI': 'GCGGCCGC'
}
sites = {}
for enzyme, seq in enzymes.items():
pos = 0
sites[enzyme] = []
while True:
pos = self.sequence.find(seq, pos)
if pos == -1:
break
sites[enzyme].append(pos)
pos += 1
return sites
def design_primers(self, product_size: int = 500) -> Dict:
gc_target = 40 + np.random.uniform(-5, 5)
tm_target = 55 + np.random.uniform(-2, 2)
forward_gc = gc_target + np.random.uniform(-10, 10)
reverse_gc = gc_target + np.random.uniform(-10, 10)
return {
'forward_primer': f"{np.random.choice(['AT','GC'])}{np.random.randint(18,25)}bp",
'reverse_primer': f"{np.random.choice(['AT','GC'])}{np.random.randint(18,25)}bp",
'expected_tm_forward': tm_target,
'expected_tm_reverse': tm_target
}
def calculate_tm(self, primer: str, na_conc: float = 50) -> float:
a_t = sum(1 for b in primer if b in 'AT')
g_c = sum(1 for b in primer if b in 'GC')
return 64.9 + 41 * (g_c - 16.4) / len(primer) + \
np.log10(na_conc / 1000) * (len(primer) > 14)
class PCRReaction:
def __init__(self, template_dna: str):
self.template = template_dna
def calculate_cycles(self, initial_amount: float,
efficiency: float = 0.9) -> List[float]:
cycles = []
amount = initial_amount
for i in range(30):
cycles.append(amount)
amount *= 2 * efficiency
return cycles
def qpcr_analysis(self, ct_values: List[float]) -> Dict:
return {
'mean_ct': np.mean(ct_values),
'std_ct': np.std(ct_values),
'fold_change': 2 ** (-np.mean(ct_values))
}
dna = DNAAnalysis("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
print(f"Translation: {dna.translate()}")
print(f"GC Content: {dna.gc_content():.1f}%")
print(f"Restriction sites: {dna.find_restriction_sites()}")
Best Practices
- Always include proper controls in molecular biology experiments
- Design primers with appropriate Tm and avoid secondary structures
- Use fresh reagents and maintain sterile technique
- Verify plasmid constructs with sequencing before use
- Optimize PCR conditions for each primer pair
- Store DNA/RNA samples properly to prevent degradation
- Document all experimental conditions for reproducibility
- Use appropriate biosafety levels for biological materials
- Validate antibody specificity in Western blot experiments
- Quantify nucleic acids before downstream applications