lamm-mit Sequence Analysis
Analyze biological sequences using Biopython. Translate DNA, compute statistics, parse sequence files, and perform basic alignments.
Overview
This skill provides sequence analysis capabilities including:
- DNA/RNA translation to protein
- Sequence statistics (GC content, molecular weight, etc.)
- Reverse complement
- FASTA/GenBank file parsing
- Sequence alignment
- Motif searching
Usage
Translate DNA to protein:
python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG"
Compute sequence statistics:
python3 {baseDir}/scripts/sequence_tools.py stats --sequence "ATGCGATCGATCGATCG"
Get reverse complement:
python3 {baseDir}/scripts/sequence_tools.py revcomp --sequence "ATGCGATCGATCG"
Parse FASTA file:
python3 {baseDir}/scripts/sequence_tools.py parse --file sequences.fasta --format fasta
Find ORFs:
python3 {baseDir}/scripts/sequence_tools.py orfs --sequence "ATGCGATCGATCGATCGTAG"
Search for motif:
python3 {baseDir}/scripts/sequence_tools.py motif --sequence "ATGCGATCGATCG" --pattern "GATC"
Commands
translate
Translate DNA/RNA sequence to protein.
| Parameter | Description | Default |
|---|---|---|
--sequence |
DNA/RNA sequence or file | Required |
--table |
Codon table (1=standard, 2=mitochondrial, etc.) | 1 |
--frame |
Reading frame (1, 2, 3, -1, -2, -3) | 1 |
--all-frames |
Translate all 6 reading frames | False |
--to-stop |
Translate until first stop codon | False |
stats
Compute sequence statistics.
| Parameter | Description | Default |
|---|---|---|
--sequence |
Sequence or file | Required |
--type |
Sequence type: dna, rna, protein, auto | auto |
Output includes:
- Length
- GC content (nucleotide)
- Molecular weight
- Base/amino acid composition
revcomp
Get reverse complement of DNA sequence.
| Parameter | Description |
|---|---|
--sequence |
DNA sequence or file |
parse
Parse sequence files (FASTA, GenBank, etc.).
| Parameter | Description | Default |
|---|---|---|
--file |
Input file path | Required |
--format |
File format: fasta, genbank, embl | auto |
--output |
Output format: summary, fasta, json | summary |
orfs
Find Open Reading Frames.
| Parameter | Description | Default |
|---|---|---|
--sequence |
DNA sequence or file | Required |
--min-length |
Minimum ORF length (codons) | 30 |
--table |
Codon table | 1 |
motif
Search for sequence motifs/patterns.
| Parameter | Description | Default |
|---|---|---|
--sequence |
Sequence to search | Required |
--pattern |
Pattern to find (supports IUPAC codes) | Required |
Examples
Translate with specific codon table:
python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCG" --table 2
Get stats for protein sequence:
python3 {baseDir}/scripts/sequence_tools.py stats --sequence "MTEYKLVVVGAGGVGKSALTIQLIQ" --type protein
Parse GenBank file and extract sequences:
python3 {baseDir}/scripts/sequence_tools.py parse --file gene.gb --format genbank --output fasta
Find all ORFs with minimum 50 codons:
python3 {baseDir}/scripts/sequence_tools.py orfs --file genome.fasta --min-length 50
Translate all 6 reading frames:
python3 {baseDir}/scripts/sequence_tools.py translate --sequence "ATGCGATCGATCGATCG" --all-frames
Codon Tables
| ID | Description |
|---|---|
| 1 | Standard |
| 2 | Vertebrate Mitochondrial |
| 3 | Yeast Mitochondrial |
| 4 | Mold/Protozoan Mitochondrial |
| 5 | Invertebrate Mitochondrial |
| 6 | Ciliate Nuclear |
| 11 | Bacterial/Archaeal/Plant Plastid |
IUPAC Codes
Nucleotides
- R = A or G (purine)
- Y = C or T (pyrimidine)
- S = G or C
- W = A or T
- K = G or T
- M = A or C
- N = any nucleotide
Amino Acids
- X = any amino acid
- B = D or N
- Z = E or Q
Notes
- Sequences can be provided directly or as file paths
- Auto-detection identifies DNA/RNA/protein sequences
- Large files are processed efficiently with streaming