Motif Search
Find patterns and motifs in biological sequences using Biopython and regex.
Required Imports
from Bio.Seq import Seq
from Bio import motifs
import re
Core Methods
find() - First Occurrence
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
pos = seq.find('GAATTC') # Returns 4 (first position)
Returns -1 if not found.
count() - Count Occurrences
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
n = seq.count('GAATTC') # Returns 2
find() with Start Position
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
first = seq.find('GAATTC') # 4
second = seq.find('GAATTC', 5) # 14 (search from position 5)
Code Patterns
Find All Occurrences
def find_all(seq, pattern):
pattern = str(pattern)
seq_str = str(seq)
positions = []
pos = seq_str.find(pattern)
while pos != -1:
positions.append(pos)
pos = seq_str.find(pattern, pos + 1)
return positions
seq = Seq('ATGCGAATTCGATCGAATTCGATC')
positions = find_all(seq, 'GAATTC') # [4, 14]
Search Both Strands
def find_both_strands(seq, pattern):
results = []
for pos in find_all(seq, pattern):
results.append(('+', pos))
rc = seq.reverse_complement()
for pos in find_all(rc, pattern):
results.append(('-', len(seq) - pos - len(pattern)))
return results
Regex Pattern Search
For ambiguous or flexible patterns:
def regex_search(seq, pattern):
seq_str = str(seq)
return [(m.start(), m.group()) for m in re.finditer(pattern, seq_str)]
# Find all ATG start codons
matches = regex_search(seq, 'ATG')
# Find TATA box variants (TATAAA with possible variations)
matches = regex_search(seq, 'TATA[AT]A[AT]')
IUPAC Ambiguity Pattern
IUPAC_DNA = {
'R': '[AG]', 'Y': '[CT]', 'S': '[GC]', 'W': '[AT]',
'K': '[GT]', 'M': '[AC]', 'B': '[CGT]', 'D': '[AGT]',
'H': '[ACT]', 'V': '[ACG]', 'N': '[ACGT]'
}
def iupac_to_regex(pattern):
regex = ''
for char in pattern:
regex += IUPAC_DNA.get(char, char)
return regex
# Search for pattern with ambiguous bases
pattern = 'GATNNTC' # N = any base
regex = iupac_to_regex(pattern) # 'GAT[ACGT][ACGT]TC'
matches = regex_search(seq, regex)
Find ORFs (Start to Stop)
def find_orfs(seq, start='ATG', stops=['TAA', 'TAG', 'TGA'], min_length=30):
seq_str = str(seq)
orfs = []
start_positions = find_all(seq, start)
for start_pos in start_positions:
for frame_offset in range(3):
if (start_pos - frame_offset) % 3 == 0:
for stop in stops:
stop_pos = start_pos + 3
while stop_pos <= len(seq) - 3:
codon = seq_str[stop_pos:stop_pos + 3]
if codon == stop:
if stop_pos - start_pos >= min_length:
orfs.append((start_pos, stop_pos + 3, seq[start_pos:stop_pos + 3]))
break
stop_pos += 3
break
return orfs
Find Repeats
def find_tandem_repeats(seq, unit_length, min_copies=2):
seq_str = str(seq)
repeats = []
for i in range(len(seq) - unit_length * min_copies + 1):
unit = seq_str[i:i + unit_length]
copies = 1
pos = i + unit_length
while pos <= len(seq) - unit_length and seq_str[pos:pos + unit_length] == unit:
copies += 1
pos += unit_length
if copies >= min_copies:
repeats.append((i, unit, copies))
return repeats
seq = Seq('ATGCAGCAGCAGCAGTTT')
repeats = find_tandem_repeats(seq, 3, 2) # Find CAG repeats
Bio.motifs Module
Create Motif from Instances
from Bio import motifs
from Bio.Seq import Seq
instances = [Seq('TACAA'), Seq('TACGA'), Seq('TACTA'), Seq('TGCAA')]
m = motifs.create(instances)
Motif Properties
# Consensus sequences
m.consensus # Most common base at each position
m.degenerate_consensus # IUPAC degenerate consensus
m.anticonsensus # Least likely sequence
# Counts and matrices
m.counts # Position frequency matrix (counts)
pwm = m.counts.normalize(pseudocounts=0.5) # Position weight matrix
pssm = pwm.log_odds() # Position-specific scoring matrix
Information Content
# Per-position information content
pwm = m.counts.normalize(pseudocounts=0.5)
pssm = pwm.log_odds()
# Mean information content (bits)
mean_ic = pssm.mean()
# Score range
max_score = pssm.max
min_score = pssm.min
# Relative entropy
print(f'Mean IC: {mean_ic:.3f} bits')
print(f'Max score: {max_score:.3f}')
print(f'Min score: {min_score:.3f}')
PSSM Search
seq = Seq('ATGCTACAAGCTACGATACTA')
# Search with threshold
for position, score in pssm.search(seq, threshold=3.0):
match = seq[position:position + len(m.consensus)]
print(f'Position {position}: {match} (score: {score:.2f})')
# Search both strands
for position, score in pssm.search(seq, threshold=3.0, both=True):
print(f'Position {position}: score {score:.2f}')
Calculate Threshold from Distribution
# Calculate score distribution from PSSM
sd = pssm.distribution()
# Get threshold for specific false positive rate
threshold = sd.threshold_fpr(0.01) # 1% FPR
# Get threshold for specific false negative rate
threshold = sd.threshold_fnr(0.1) # 10% FNR
# Balanced threshold
threshold = sd.threshold_balanced(1000) # For sequence of length 1000
Reading Motif Files
JASPAR Format
from Bio import motifs
with open('motif.jaspar') as f:
m = motifs.read(f, 'jaspar')
print(f'Name: {m.name}')
print(f'Matrix ID: {m.matrix_id}')
print(m.counts)
MEME Format
with open('meme.txt') as f:
record = motifs.parse(f, 'meme')
for m in record:
print(f'{m.name}: {m.consensus}')
TRANSFAC Format
with open('motif.transfac') as f:
record = motifs.parse(f, 'transfac')
for m in record:
print(f'{m.name}: {m.consensus}')
Write Motifs
# Write to JASPAR format
with open('output.jaspar', 'w') as f:
f.write(m.format('jaspar'))
# Write to TRANSFAC format
with open('output.transfac', 'w') as f:
f.write(m.format('transfac'))
Common Motif Patterns
| Motif | Pattern | Description |
|---|---|---|
| Start codon | ATG |
Translation initiation |
| Stop codons | TAA|TAG|TGA |
Translation termination |
| Kozak | [AG]CCATGG |
Eukaryotic translation initiation |
| TATA box | TATA[AT]A[AT] |
Promoter element |
| GC box | GGGCGG |
Promoter element (Sp1) |
| CAAT box | CCAAT |
Promoter element |
| Poly-A signal | AATAAA |
mRNA polyadenylation |
| E-box | CA[ACGT]{2}TG |
bHLH TF binding |
| CpG island | High CG density | Promoter regions |
Common Errors
| Error | Cause | Solution |
|---|---|---|
| No matches found | Case mismatch | Use .upper() on both |
| Missing matches | Pattern on opposite strand | Search reverse complement too |
TypeError |
Mixing Seq and string | Use str() conversion |
ValueError parsing motif |
Wrong format specified | Check file format |
Decision Tree
Need to find patterns in sequence?
├── Exact match?
│ ├── Just need position of first? → seq.find()
│ ├── Need count? → seq.count()
│ └── Need all positions? → loop with find()
├── Fuzzy/ambiguous pattern?
│ └── Use regex with re.finditer()
├── IUPAC pattern?
│ └── Convert to regex, then search
├── Both strands?
│ └── Search original and reverse_complement
├── Probabilistic (PWM/PSSM)?
│ └── Use Bio.motifs
│ ├── Create from instances → motifs.create()
│ ├── Read from file → motifs.read() / parse()
│ ├── Get consensus → m.consensus, m.degenerate_consensus
│ ├── Search sequence → pssm.search()
│ └── Calculate threshold → distribution.threshold_fpr()
└── Restriction sites?
└── Use restriction-analysis skill (Bio.Restriction)
Related Skills
- seq-objects - Create Seq objects for searching
- reverse-complement - Search both strands for motifs
- sequence-io/filter-sequences - Filter sequences that contain specific motifs
- restriction-analysis/restriction-sites - For restriction enzyme site searching
- database-access - Download motif databases from NCBI/JASPAR