NeuralBlitz Biotechnology
What I Do
Biotechnology applies biological systems and organisms to develop products and technologies. I cover genetic engineering, recombinant DNA technology, bioprocessing, synthetic biology, biopharmaceutical manufacturing, biofuel production, and agricultural biotechnology. I help design bioprocesses, develop engineered organisms, and scale up production.
When to Use Me
- Designing recombinant DNA constructs and vectors
- Developing microbial strains for production
- Optimizing bioprocess conditions and scale-up
- Working with cell culture and biopharmaceuticals
- Developing synthetic biology circuits
- Engineering enzymes and metabolic pathways
- Designing CRISPR gene editing experiments
Core Concepts
- Recombinant DNA: Plasmids, restriction enzymes, ligation, transformation
- Genetic Engineering: Gene insertion, deletion, modification
- Synthetic Biology: Genetic circuits, BioBrick standards, gene design
- Bioprocessing: Fermentation, bioreactors, upstream/downstream processing
- Cell Culture: Mammalian cell lines, stem cells, media optimization
- Protein Engineering: Directed evolution, rational design, library screening
- Enzyme Technology: Immobilization, cofactor regeneration, kinetics
- Downstream Processing: Purification, chromatography, formulation
- Scale-up: Mixing, oxygen transfer, heat transfer, process parameters
- Quality Control: Purity, potency, identity testing, stability
Code Examples
import numpy as np
from typing import List, Dict, Tuple
class RecombinantDNA:
def __init__(self, vector_name: str):
self.vector = vector_name
def design_gibson_assembly(self, insert_seq: str,
vector_seq: str,
homology_length: int = 40) -> Dict:
left_arm = vector_seq[-homology_length:]
right_arm = vector_seq[:homology_length]
construct = left_arm + insert_seq + right_arm
return {
'full_construct': construct,
'forward_primer': 'ATG' + construct[:20],
'reverse_primer': construct[-21:] + 'TCA'
}
def calculate_gibson_efficiency(self, fragment_conc: float,
vector_conc: float,
insert_size: int,
vector_size: int) -> float:
insert_molar = fragment_conc / insert_size
vector_molar = vector_conc / vector_size
ratio = 3 * insert_molar / vector_molar
return min(ratio, 5)
def crispr_guide_design(self, target_sequence: str,
pam: str = "NGG") -> List[Dict]:
guides = []
for i in range(len(target_sequence) - 2):
if target_sequence[i+2:i+4] == pam:
guide = target_sequence[i:i+20]
gc = sum(1 for b in guide if b in 'GC') / 20
if 0.4 < gc < 0.8:
guides.append({
'guide_rna': guide,
'position': i,
'gc_content': gc,
'score': 1 - abs(0.5 - gc)
})
return sorted(guides, key=lambda x: x['score'], reverse=True)[:5]
def off_target_prediction(self, guide: str,
genome_sequence: str) -> List[str]:
off_targets = []
for i in range(len(genome_sequence) - 20):
mismatch = sum(1 for a, b in zip(guide, genome_sequence[i:i+20]) if a != b)
if 0 < mismatch <= 3:
off_targets.append(f"Position {i}: {mismatch} mismatches")
return off_targets
class BioprocessEngineering:
def __init__(self, organism: str):
self.organism = organism
def calculate_yield_coefficient(self, substrate_consumed: float,
biomass_produced: float,
product_formed: float) -> Dict:
Y_xs = biomass_produced / substrate_consumed
Y_ps = product_formed / substrate_consumed
return {
'YXS': Y_xs,
'YPS': Y_ps,
'substrate_efficiency': biomass_produced / (substrate_consumed + 1e-9)
}
def calculate_oxygen_transfer_rate(self, kla: float,
c_star: float,
c: float) -> float:
return kla * (c_star - c)
def predict_specific_growth_rate(self, substrate: float,
mu_max: float,
ks: float) -> float:
return mu_max * substrate / (ks + substrate)
def scale_up_parameters(self, small_scale: Dict,
scale_factor: float) -> Dict:
power_small = small_scale.get('power', 100)
volume_small = small_scale.get('volume', 1)
return {
'volume': volume_small * scale_factor,
'power': power_small * (scale_factor ** 0.67),
'rpm': small_scale.get('rpm', 500) * (scale_factor ** -0.33)
}
def calculate_pff(self, permeate_flux: float,
membrane_area: float,
feed_concentration: float) -> float:
return permeate_flux * membrane_area * feed_concentration
class ProteinEngineering:
def __init__(self, protein_name: str):
self.protein = protein_name
def directed_evolution_library(self, wild_type_seq: str,
mutation_rate: float) -> List[str]:
library = [wild_type_seq]
for i in range(len(wild_type_seq)):
if np.random.random() < mutation_rate:
for aa in 'ACDEFGHIKLMNPQRSTVWY':
if aa != wild_type_seq[i]:
new_seq = wild_type_seq[:i] + aa + wild_type_seq[i+1:]
library.append(new_seq)
return library[:1000]
def calculate_mutational_load(self, library_size: int,
target_protein_size: int) -> float:
theoretical_library = 19 ** target_protein_size
coverage = library_size / theoretical_library
return coverage
def thermal_stability_prediction(self, mutations: List[str],
wt_tm: float) -> Dict:
return {'predicted_Tm': wt_tm + 2, 'delta_Tm': 2}
class BiopharmaceuticalManufacturing:
def __init__(self, product: str):
self.product = product
def calculate_cell_density(self, viable_count: float,
viability: float,
volume: float) -> Dict:
total_cells = viable_count * volume
viable_cells = total_cells * viability / 100
return {
'total_cells_ml': total_cells,
'viable_cells_ml': viable_cells,
'viability': viability
}
def purification_yield(self, load_mass: float,
eluate_mass: float,
volume_load: float,
volume_eluate: float) -> Dict:
yield_percent = eluate_mass / load_mass * 100
concentration_factor = (eluate_mass / volume_eluate) / (load_mass / volume_load)
return {
'yield': yield_percent,
'concentration_factor': concentration_factor
}
def calculate_hcp_removal(self, hcp_before: float,
hcp_after: float,
purification_factor: float) -> Dict:
log_reduction = np.log10(hcp_before / hcp_after)
return {
'log_reduction': log_reduction,
'purification_factor': purification_factor
}
crispr = RecombinantDNA("pX330")
guides = crispr.crispr_guide_design("ATCGATCGATCGATCGATCG")
print(f"Top 5 guides: {len(guides)} designed")
bio = BioprocessEngineering("E.coli")
scale = bio.scale_up_parameters({'power': 100, 'volume': 1, 'rpm': 500}, 1000)
print(f"Scaled up - Volume: {scale['volume']:.0f}L, Power: {scale['power']:.0f}W")
Best Practices
- Use proper vector backbones with selection markers
- Verify all constructs with sequencing before use
- Optimize expression conditions for each protein
- Maintain detailed notebooks for strain and clone tracking
- Apply QbD principles for bioprocess development
- Use appropriate analytical characterization methods
- Follow GMP guidelines for therapeutic products
- Monitor critical process parameters continuously
- Implement proper contamination controls
- Validate purification processes for each product