miRNA-seq Processing and Analysis
When to Use
- Processing small RNA-seq FASTQ files (18-30 nt inserts, 3' adapter-ligated libraries)
- Quantifying mature miRNA expression against miRBase (mature.fa / GFF3)
- Running differential miRNA expression between conditions (tumor vs normal, treated vs control)
- Predicting miRNA-mRNA targets via seed-region matching (TargetScan-style) or looking up validated targets in miRTarBase
- Distinguishing isomiRs / arm switching (
-5pvs-3p) in count data
Version Compatibility
- cutadapt ≥ 4.0, bowtie 1.3.x (short-read aligner, not bowtie2 — needed for ungapped 1-mismatch miRNA mapping)
- Subread/featureCounts ≥ 2.0, miRBase release 22.1 (hg38 coordinates)
- Python: pandas ≥ 2.0, scipy ≥ 1.10, statsmodels ≥ 0.14
- R: DESeq2 ≥ 1.42 (Bioconductor 3.18), on R ≥ 4.3
Prerequisites
pip install pandas scipy statsmodels(Python DE path);BiocManager::install("DESeq2")(R path)- cutadapt, bowtie, subread (featureCounts) on PATH
- miRBase
mature.fa(orhairpin.fa) and species-specific miRBase GFF3 for the reference genome build - Familiarity with
bio-read-qc-adapter-trimmingandbio-differential-expression-deseq2-basics
miRNA Naming Convention
miR-21/miR-21-5p: mature guide strand, 5' armmiR-21-3p: 3' arm (formerly annotatedmiR-21*)hsa-miR-21-5p: species prefix (human) + armmir-21(lowercase): the gene/precursor locus, not the mature product- Seed region = positions 2-7 of the mature miRNA — the primary determinant of target recognition
Library Design
Standard poly-A-selected RNA-seq fails for miRNAs: they lack poly-A tails and are already too short to fragment further. Use 3'-adapter-ligation-based small RNA libraries (e.g. Illumina TruSeq Small RNA) with 50 bp single-end sequencing — sufficient since inserts are 18-25 nt.
Processing Pipeline
Goal: go from raw small-RNA FASTQ to a per-sample miRNA count matrix. Approach: trim the 3' adapter with size selection (16-28 nt keeps mature miRNAs and excludes untrimmed adapter dimers), align with Bowtie in ungapped mode with up to 1 mismatch, then count reads over miRBase mature-miRNA features.
# 1. Trim 3' adapter, keep only 16-28 nt inserts, discard reads with no adapter found
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 16 -M 28 \
--discard-untrimmed \
-j 8 -o trimmed.fastq.gz sample.fastq.gz
# 2. Build a Bowtie index from miRBase mature sequences and align
# --norc: miRNA libraries are stranded, only match the sense strand
# -v 1: allow up to 1 mismatch (captures isomiRs with SNPs/editing)
# -m 5: discard reads mapping to >5 loci (multi-mapping precursors)
bowtie-build mature.fa mirbase_index
bowtie -x mirbase_index --norc -v 1 -m 5 -p 8 \
-q trimmed.fastq.gz -S aligned.sam
samtools sort -o aligned.bam aligned.sam && samtools index aligned.bam
# 3. Quantify: count reads per mature miRNA feature (strand-specific, -s 1)
featureCounts -a hg38_mirbase_v22.gff3 -F GTF \
-o raw_counts.txt -t miRNA -g Name -s 1 aligned.bam
QC Thresholds
| Metric | Acceptable |
|---|---|
| Total raw reads | >5M per sample |
| Adapter trimming rate | >60% (most reads should contain the adapter) |
| Alignment rate to miRBase | >50% |
| Top expressed miRNA | <50% of total library |
Differential Expression
Goal: find miRNAs whose expression differs between two conditions from a raw count matrix. Approach: for a quick Python-side screen, CPM-normalize, log2-transform, and run a per-miRNA t-test with BH correction; for a publication-grade result, model raw counts directly with DESeq2's negative-binomial GLM (preferred — CPM/t-test ignores mean-variance structure at low counts).
import numpy as np
import pandas as pd
from scipy.stats import ttest_ind
from statsmodels.stats.multitest import multipletests
def mirna_de_screen(counts_df: pd.DataFrame, group_a_prefix: str, group_b_prefix: str,
fc_threshold: float = 1.0, fdr: float = 0.05) -> pd.DataFrame:
"""Quick CPM + t-test differential expression screen for a miRNA count matrix.
counts_df: samples as columns, miRNA IDs as index, raw read counts.
group_a_prefix / group_b_prefix: column-name prefixes identifying each group
(e.g. "Normal", "Tumor").
Returns a DataFrame with log2FC, p-value, BH-adjusted p-value, and a
significance flag. NOTE: for a final analysis prefer DESeq2 (see R block
below) — it models raw counts with a negative-binomial GLM instead of
treating log-CPM as normally distributed.
"""
lib_sizes = counts_df.sum(axis=0)
cpm = counts_df / lib_sizes * 1e6
log2_cpm = np.log2(cpm + 1)
group_a = [c for c in log2_cpm.columns if c.startswith(group_a_prefix)]
group_b = [c for c in log2_cpm.columns if c.startswith(group_b_prefix)]
rows = []
for mirna in log2_cpm.index:
a_vals = log2_cpm.loc[mirna, group_a].values
b_vals = log2_cpm.loc[mirna, group_b].values
log2fc = b_vals.mean() - a_vals.mean()
_, pval = ttest_ind(b_vals, a_vals)
rows.append({"miRNA": mirna, "log2FC": log2fc, "pvalue": pval})
de_df = pd.DataFrame(rows)
_, padj, _, _ = multipletests(de_df["pvalue"].fillna(1), method="fdr_bh")
de_df["padj"] = padj
de_df["significant"] = (de_df["padj"] < fdr) & (de_df["log2FC"].abs() > fc_threshold)
return de_df.sort_values("padj")
# DESeq2 on the raw miRBase count matrix — preferred over CPM/t-test above.
library(DESeq2)
counts <- read.delim("raw_counts.txt", row.names = 1, comment.char = "#")
coldata <- data.frame(
row.names = colnames(counts),
condition = factor(rep(c("Normal", "Tumor"), each = ncol(counts) / 2))
)
dds <- DESeqDataSetFromMatrix(countData = counts, colData = coldata, design = ~condition)
dds <- dds[rowSums(counts(dds) >= 10) >= 3, ] # filter low-count miRNAs
dds <- DESeq(dds)
res <- results(dds, contrast = c("condition", "Tumor", "Normal"), alpha = 0.05)
res <- res[order(res$padj), ]
sig <- subset(res, padj < 0.05 & abs(log2FoldChange) > 1)
write.csv(as.data.frame(res), "mirna_de_results.csv")
Target Prediction
Goal: find candidate 3'UTR target sites for a mature miRNA's seed sequence. Approach: reverse-complement the seed (positions 2-7), scan the UTR for matches, and classify site strength by whether the flanking bases match the 8mer/7mer-m8/7mer-A1 rules.
| Site type | Definition | Repression |
|---|---|---|
| 8mer | Seed match + A at UTR position 1 + match at position 8 | Strongest |
| 7mer-m8 | Seed match + match at position 8 | Strong |
| 7mer-A1 | Seed match + A at position 1 | Moderate |
| 6mer | Seed match only | Weak |
def find_seed_sites(mirna_seq: str, utr_seq: str, seed_start: int = 1, seed_end: int = 7) -> list[dict]:
"""Find candidate seed-match sites for a miRNA in a 3'UTR sequence.
mirna_seq: mature miRNA sequence, 5'->3', RNA alphabet (A/C/G/U).
utr_seq: 3'UTR sequence (RNA or DNA alphabet).
seed_start/seed_end: 0-indexed half-open window, default positions 2-7
(i.e. index 1:7) per the canonical miRNA seed definition.
Returns a list of {position, site_type, match} dicts, one per hit.
Simplification: classifies 8mer/7mer variants using only the flanking-A
heuristic (real TargetScan additionally requires exact Watson-Crick
pairing at UTR position 8) — good enough for screening, not for
publication-grade site calls.
"""
seed = mirna_seq[seed_start:seed_end]
complement = str.maketrans("ACGUTacgut", "UGCAAugcaa")
seed_rc_dna = seed.translate(complement)[::-1].replace("U", "T")
utr_dna = utr_seq.replace("U", "T").upper()
hits = []
for i in range(len(utr_dna) - len(seed_rc_dna) + 1):
if utr_dna[i:i + len(seed_rc_dna)] != seed_rc_dna:
continue
has_a_upstream = i > 0 and utr_dna[i - 1] == "A"
has_match_pos8 = i + len(seed_rc_dna) < len(utr_dna) and utr_dna[i + len(seed_rc_dna)] == "A"
if has_a_upstream and has_match_pos8:
site_type = "8mer"
elif has_match_pos8:
site_type = "7mer-m8"
elif has_a_upstream:
site_type = "7mer-A1"
else:
site_type = "6mer"
hits.append({"position": i, "site_type": site_type, "match": utr_dna[i:i + len(seed_rc_dna)]})
return hits
Databases
- TargetScan 8.0: context++ score (seed type, site accessibility, conservation)
- miRDB: machine-learning-based MirTarget score
- miRTarBase: experimentally validated targets (CLASH, luciferase reporter assays)
Pitfalls
- Adapter contamination: most reads must contain the adapter;
--discard-untrimmedremoves reads where none was found (usually contaminants, not real inserts) - isomiR variation: 5'/3' end heterogeneity is biologically real; decide up front whether to collapse isomiRs into one miRNA count or keep them separate
- Wrong aligner mode:
bowtie2local alignment over-calls multi-mappers for 20-22 nt reads — usebowtie(v1) with-v 1 -m 5, not bowtie2, for mature miRNA mapping - CPM/t-test on low counts: log-CPM t-tests are anti-conservative at low read depth; use DESeq2/edgeR's NB model for the final DE call
- Multiple testing: hundreds of miRNAs are tested at once — always apply BH/FDR correction, never raw p-values
See Also
bio-read-qc-adapter-trimming— cutadapt trimming details and QCbio-differential-expression-deseq2-basics— DESeq2 model and contrasts in depthbio-rna-quantification-featurecounts-counting— featureCounts options and strandednessbio-small-rna-seq-target-prediction— dedicated seed-match/TargetScan target prediction skill