Character Encodings and Binary Data in Bioinformatics
When to Use
UnicodeDecodeError: 'utf-8' codec can't decode byte 0x...when opening a file downloaded from an external database or exported from Windows.- FASTA/GFF/GenBank parsing gives sequences that are one character too long, or headers that start with an invisible character.
- Text copy-pasted from a paper or Word document (author names, organism names, Greek letters like α/β, µ, °) looks garbled after being read into Python.
- A gene/protein name with special characters (
HLA-A*02:01,C/EBPα) needs to go into a URL query (UniProt, NCBI E-utilities). - Need to detect or convert a file's encoding (e.g., CP1251 Cyrillic annotations) to UTF-8 before downstream tools choke on it.
Version Compatibility
Python ≥3.9 (all examples use only the standard library: codecs/str.encode/str.decode, unicodedata, urllib.parse). Optional: chardet ≥5.0 for encoding auto-detection.
Prerequisites
- Basic Python string/bytes distinction (
strvsbytes,.encode()/.decode()). pip install chardet(optional, only needed for auto-detection).
From Bits to Bytes
| Notation | Example | Meaning |
|---|---|---|
| Binary | 01000001 |
8 bits = 1 byte |
| Decimal | 65 |
Human-friendly |
| Hexadecimal | 0x41 |
2 hex digits = 1 byte |
for value in [0, 10, 32, 48, 65, 90, 97, 122, 127, 200, 255]:
char = chr(value) if 32 <= value < 127 else '--'
print(f"{value:7d} {format(value, '08b'):>10} 0x{format(value, '02X')} '{char}'")
Bioinformatics relevance: DNA (ATGCN), RNA (AUGC), and amino acid codes are pure ASCII (byte values 0-127) -- sequence data itself never has encoding issues. Problems arise in annotations, author names, organism names, and free-text fields, and in FASTQ quality strings (Phred+33 maps quality 0-93 to ASCII 33-126).
# FASTQ quality scores: Phred+33 maps quality 0-93 to ASCII 33-126
quality_string = "IIIIIIIIFFFFFFDDDDDBBBB"
for char in quality_string[:6]:
phred = ord(char) - 33
print(f"'{char}' -> Phred {phred} -> error rate {10 ** (-phred / 10):.6f}")
Core Operations
Goal: detect why a file fails to decode, repair mojibake, and normalize the text before parsing. Approach: try encodings in priority order (UTF-8 with BOM check first, Latin-1 last since it never raises), fix already-mis-decoded text by round-tripping through the wrong encoding, and strip invisible Unicode noise from biological sequences.
def read_text_file(filepath):
"""Read a text file, trying common bioinformatics encodings in order.
Priority:
1. utf-8-sig (UTF-8, auto-strips a BOM if a Windows editor added one)
2. utf-8 (modern standard, no BOM)
3. latin-1 (never fails -- last-resort fallback, may give wrong characters)
"""
for encoding in ('utf-8-sig', 'utf-8', 'latin-1'):
try:
with open(filepath, 'r', encoding=encoding) as f:
content = f.read()
if encoding == 'latin-1':
print(f"WARNING: fell back to Latin-1 for {filepath}; "
"some characters may be wrong -- consider converting to UTF-8.")
return content
except UnicodeDecodeError:
continue
raise ValueError(f"Could not decode {filepath} with any known encoding")
def fix_mojibake(text, wrong_encoding='latin-1', right_encoding='utf-8'):
"""Repair text that was UTF-8 but got decoded as Latin-1 (classic mojibake).
Round-trips through the wrong encoding's byte representation, then
decodes those bytes with the correct encoding.
"""
return text.encode(wrong_encoding).decode(right_encoding)
# Example: alpha-helix mis-decoded, then repaired
original = "α-helix structure"
utf8_bytes = original.encode('utf-8')
wrong = utf8_bytes.decode('latin-1') # garbled, but does not raise
fixed = fix_mojibake(wrong)
assert fixed == original
import unicodedata
def sanitize_sequence(seq, valid_chars='ATGCNatgcn'):
"""Strip characters that are not valid sequence letters or expected whitespace.
Catches copy-paste artifacts like zero-width space (U+200B) and
non-breaking space (U+00A0) that look identical to normal text but
break equality checks, split(), and length calculations.
"""
valid_set = set(valid_chars)
cleaned, removed = [], []
for char in seq:
if char in valid_set:
cleaned.append(char)
elif char not in ('\n', '\r', ' ', '\t'):
removed.append(f"'{char}' ({unicodedata.name(char, f'U+{ord(char):04X}')})")
if removed:
print(f"WARNING: removed {len(removed)} unexpected characters: {', '.join(removed)}")
return ''.join(cleaned)
messy = "ATGCGA TCGA\r\nGGGTTT"
print(sanitize_sequence(messy)) # -> ATGCGATCGAGGGTTT
def parse_fasta_robust(raw_bytes):
"""Parse FASTA from raw bytes, handling BOM and any line-ending style."""
text = raw_bytes.decode('utf-8-sig').replace('\r\n', '\n').replace('\r', '\n')
sequences, current_header, current_seq = {}, None, []
for line in text.strip().split('\n'):
line = line.strip()
if line.startswith('>'):
if current_header is not None:
sequences[current_header] = ''.join(current_seq)
current_header, current_seq = line[1:], []
elif line:
current_seq.append(line)
if current_header is not None:
sequences[current_header] = ''.join(current_seq)
return sequences
windows_fasta = b">gene1\r\nATGCGATCGA\r\nTTTAAAGGGC\r\n"
result = parse_fasta_robust(windows_fasta)
assert result['gene1'] == 'ATGCGATCGATTTAAAGGGC'
Goal: detect an unknown encoding, and percent-encode gene/protein names for database URLs.
Approach: use chardet when the source encoding is unknown; use urllib.parse.quote/unquote for E-utilities/UniProt query strings containing *, /, +, or Greek letters.
from urllib.parse import quote, unquote
try:
import chardet
def detect_encoding(raw_bytes):
"""Return chardet's best-guess encoding and confidence for raw bytes."""
result = chardet.detect(raw_bytes)
return result['encoding'], result['confidence']
guess, conf = detect_encoding("Анализ экспрессии генов".encode('cp1251'))
print(f"detected {guess} (confidence {conf:.0%})")
except ImportError:
print("chardet not installed: pip install chardet")
# HLA allele / transcription factor names in a UniProt/NCBI query URL
gene_queries = ["HLA-A*02:01", "C/EBPα", "Na+/K+ ATPase"]
base_url = "https://www.uniprot.org/uniprot/?query="
for gene in gene_queries:
print(f"{gene:<15} -> {base_url}{quote(gene, safe='')}")
encoded_url = "https://www.ncbi.nlm.nih.gov/gene/?term=C%2FEBP%CE%B1"
print(unquote(encoded_url)) # -> .../gene/?term=C/EBPα
Pitfalls
- Latin-1 never fails -- but that does not mean it is right: Latin-1 decodes every byte 0-255 successfully, silently producing wrong characters (mojibake) when the file is actually UTF-8 with multi-byte sequences. Never use it as a first choice, only as a documented fallback.
- UTF-8 BOM confusion: Windows editors may prepend
\xef\xbb\xbf. Decoding with plain'utf-8'leaves an invisibleU+FEFFat position 0, breakingline.startswith('>')FASTA header checks. Use'utf-8-sig'to auto-strip it. - Windows line endings in sequences: a trailing
\rin a DNA line is invisible in most editors but breaks sequence length, regex matches, andsplit()results. Normalize with.replace('\r\n', '\n').replace('\r', '\n')before parsing. - Non-breaking space vs. regular space:
looks identical to' 'but is a different byte sequence --split()and exact-match database lookups treat them differently. - Coordinate systems: BED is 0-based half-open; VCF/GFF is 1-based inclusive -- mixing these causes off-by-one errors independent of encoding.
See Also
python-bio-file-operations-- general file reading/writing patterns this builds on.python-bio-sequences-- working withSeqobjects once FASTA text is decoded and clean.python-bio-strings-- string methods (.strip(),.split(),.encode()/.decode()) used throughout.bio-core-biological-databases-- building NCBI/UniProt query URLs with percent-encoded gene names.