Python Bio Python Introduction

Python Introduction for Bioinformatics

When to Use

• Onboarding someone new to Python who wants a biology-flavored first program (nucleotide counting, GC content).
• Choosing which scientific/bio Python packages to install for a given task (BioPython, pandas, pysam, scanpy, scikit-bio).
• Setting up a reproducible environment with venv or conda before starting any bioinformatics project.
• Explaining core language pitfalls (f-strings, mutable defaults, 0- vs 1-based coordinates) that trip up biologists writing their first scripts.
• Quick BioPython Seq demo (complement, reverse complement, transcription, translation).

Version Compatibility

• Python ≥ 3.10 (f-strings, str.maketrans, walrus operator all stable)
• biopython ≥ 1.83 (Bio.SeqUtils.gc_fraction; older code used the removed GC() function)
• pandas ≥ 2.1, numpy ≥ 1.26 (only needed once you move past raw strings to tabular data)

Prerequisites

• No prior programming experience required for this skill itself.
• pip install biopython (or conda install -c bioconda biopython) for the Bio.Seq demo.
• A terminal for venv/conda environment setup.

Goal: Count nucleotides and compute GC content from a raw DNA string

Approach: Use str.count() for a one-off tally, or a loop over a dict when you need per-base percentages in one pass. GC content (fraction of G+C) is one of the first statistics computed on any new sequence — it correlates with melting temperature and gene density.

def nucleotide_counts(dna: str) -> dict:
    """Return counts of A/C/G/T in a DNA string using str.count()."""
    dna = dna.upper()
    return {base: dna.count(base) for base in "ACGT"}


def nucleotide_percentages(dna: str) -> dict:
    """Return per-base percentages via a single pass through the sequence."""
    counts = {"A": 0, "C": 0, "G": 0, "T": 0}
    for nt in dna.upper():
        if nt in counts:
            counts[nt] += 1
    total = len(dna)
    return {base: count / total * 100 for base, count in counts.items()}


def gc_content(sequence: str) -> float:
    """Calculate GC content of a DNA sequence as a percentage (0-100)."""
    sequence = sequence.upper()
    gc = sequence.count("G") + sequence.count("C")
    return gc / len(sequence) * 100


if __name__ == "__main__":
    # From Rosalind "Counting DNA Nucleotides"
    dna = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

    counts = nucleotide_counts(dna)
    print(f"Counts: {counts}  (total={sum(counts.values())}, len={len(dna)})")

    gc = gc_content(dna)
    print(f"GC content: {gc:.2f}%")
    if gc < 40:
        print("AT-rich (low GC).")
    elif gc > 60:
        print("GC-rich.")
    else:
        print("Moderate GC range.")

Goal: Basic sequence manipulation with BioPython's Seq

Approach: Bio.Seq.Seq wraps a string with biology-aware methods (complement, reverse_complement, transcribe, translate) so you don't hand-roll base-pairing tables for routine tasks.

def biopython_demo(sequence: str = "ATGAAACCCGGGTAA") -> None:
    """Show core Bio.Seq operations: complement, RC, transcription, translation, GC."""
    from Bio.Seq import Seq
    from Bio.SeqUtils import gc_fraction

    seq = Seq(sequence)
    print(f"Sequence:           {seq}")
    print(f"Complement:         {seq.complement()}")
    print(f"Reverse complement: {seq.reverse_complement()}")
    print(f"Transcribed (RNA):  {seq.transcribe()}")
    print(f"Translated:         {seq.translate()}")
    print(f"GC fraction:        {gc_fraction(seq):.3f}")


if __name__ == "__main__":
    biopython_demo()

Goal: Set up an isolated environment for a bioinformatics project

Approach: Use venv for a pure-Python project; use conda when you also need compiled, non-Python tools (BLAST, samtools) in the same environment.

# --- pip / venv ---
python -m venv bioenv
source bioenv/bin/activate        # macOS/Linux; use bioenv\Scripts\activate on Windows
pip install biopython pandas numpy matplotlib seaborn
pip install -r requirements.txt   # if you have one
pip list
deactivate

# --- conda (preferred when you also need CLI tools like blast/samtools) ---
conda create -n bioenv python=3.11
conda activate bioenv
conda install -c conda-forge biopython pandas matplotlib
conda install -c bioconda blast samtools

Pitfalls

• f-strings vs % formatting: f-strings (f"GC = {gc:.2f}%") are the modern approach (Python ≥3.6); older code uses "GC = %.2f%%" % gc.
• print() returns None: never write result = print(...) expecting to capture output — assign the value directly instead.
• Mutable default arguments: never def f(x=[]); use def f(x=None): x = x if x is not None else [].
• 0-based vs 1-based coordinates: Python slicing/ranges are half-open [start, stop) and 0-based, but genomic coordinate systems (GFF, VCF, 1-based) are not — off-by-one errors are the most common bug when converting between them.
• Deep vs shallow copy: nested structures (e.g. a list of per-sample count dicts) need copy.deepcopy(); list.copy() only copies the top level.
• Bio.SeqUtils.GC() is gone: newer BioPython uses gc_fraction() (returns 0-1, not 0-100) — multiply by 100 if you want a percentage.

See Also

• biopython — deeper Bio.Seq/Bio.SeqIO/Bio.SeqUtils reference
• bio-sequence-io-read-sequences — reading FASTA/FASTQ files instead of raw strings
• bio-sequence-manipulation-seq-objects — Seq object operations in depth
• bio-sequence-manipulation-transcription-translation — transcription/translation details