String Matching Algorithms
When to Use
- Naive: short patterns (m small), large alphabet, or one-off search; no setup cost
- KMP: guaranteed O(n+m), single pattern, repetitive pattern structure (e.g., ATATATG), streaming input
- Rabin-Karp: multiple patterns of the same length (hash all, scan once), plagiarism/duplicate detection
- DFA: small fixed alphabet (DNA: |Σ|=4), many texts against the same pattern, need O(1) per character with no backtracking
- Explaining/implementing the KMP failure function, rolling hash, or a pattern automaton from scratch
Version Compatibility
Pure Python standard library only — no third-party dependencies. Works on Python ≥3.9 (uses list[int] built-in generics); drop the type hints for 3.8 or earlier.
Prerequisites
- Comfortable with Python strings, lists, and dict indexing
- Basic Big-O intuition (the point of these algorithms is avoiding re-scanning text)
- No packages to install
Quick Reference
| Algorithm | Preprocessing | Search | Space | Notes |
|---|---|---|---|---|
| Naive | O(1) | O(n×m) | O(1) | Best case O(n) with large alphabet |
| KMP | O(m) | O(n) | O(m) | Never backtracks in text |
| Rabin-Karp | O(m) | O(n+m) avg, O(n×m) worst | O(1) | k patterns: O(n + k×m) |
| DFA | O(m×|Σ|) | O(n) | O(m×|Σ|) | O(1) per char, no fallback logic |
Naive and KMP Search
Goal: find every (possibly overlapping) occurrence of a single pattern in a text.
Approach: naive search brute-forces every start position; KMP precomputes a prefix (failure) function sp[i] — the length of the longest proper prefix of pattern[0:i+1] that is also a suffix — so on a mismatch the pattern pointer jumps back to sp[j-1] instead of restarting from 0.
def naive_search(text: str, pattern: str) -> list[int]:
"""Return all start indices where pattern occurs in text (brute force)."""
n, m = len(text), len(pattern)
return [i for i in range(n - m + 1) if text[i:i + m] == pattern]
def prefix_function(p: str) -> list[int]:
"""KMP failure function: sp[i] = longest proper prefix of p[:i+1] that is also a suffix."""
sp = [0] * len(p)
j = 0
for i in range(1, len(p)):
while j >= 0 and p[j] != p[i]:
j = sp[j - 1] if j - 1 >= 0 else -1
j += 1
sp[i] = j
return sp
def kmp_search(text: str, pattern: str) -> list[int]:
"""Find all (including overlapping) occurrences of pattern in text in O(n+m)."""
if not pattern or len(pattern) > len(text):
return []
matches = []
f = prefix_function(pattern)
n, m = len(text), len(pattern)
j = 0
for i in range(n):
while j >= 0 and text[i] != pattern[j]:
j = f[j - 1] if j - 1 >= 0 else -1
j += 1
if j == m:
matches.append(i - m + 1)
j = f[m - 1] # allow overlapping matches, e.g. "AA" in "AAAA"
return matches
Rabin-Karp Rolling Hash
Goal: search one pattern, or many same-length patterns at once, using a hash instead of character comparison.
Approach: hash the pattern (and each same-length window of text) with a polynomial rolling hash hash = (s[0]·b^(m-1) + s[1]·b^(m-2) + ... + s[m-1]) mod q; sliding the window one position updates the hash in O(1) via (base * (th - ord(text[i]) * h) + ord(text[i+m])) % mod. A hash match is only a candidate — always verify with a direct string compare to rule out collisions.
def rabin_karp_all(text: str, pattern: str, base: int = 256, mod: int = 1_000_000_007) -> list[int]:
"""Find all occurrences of pattern in text using a rolling hash, O(n+m) average."""
n, m = len(text), len(pattern)
if m == 0 or m > n:
return []
h = pow(base, m - 1, mod) # base^(m-1) mod q, precomputed once
ph = th = 0
for i in range(m):
ph = (base * ph + ord(pattern[i])) % mod
th = (base * th + ord(text[i])) % mod
matches = []
for i in range(n - m + 1):
if th == ph and text[i:i + m] == pattern: # verify to avoid spurious hash collisions
matches.append(i)
if i < n - m:
th = (base * (th - ord(text[i]) * h) + ord(text[i + m])) % mod
return matches
def rabin_karp_multi(text: str, patterns: list[str], base: int = 256, mod: int = 1_000_000_007) -> dict[str, list[int]]:
"""Search k same-length patterns (e.g. restriction enzyme sites) in a single pass over text."""
if not patterns:
return {}
m = len(patterns[0])
h = pow(base, m - 1, mod)
pattern_hashes: dict[int, list[str]] = {}
for p in patterns:
ph = 0
for c in p:
ph = (base * ph + ord(c)) % mod
pattern_hashes.setdefault(ph, []).append(p)
results = {p: [] for p in patterns}
th = 0
for c in text[:m]:
th = (base * th + ord(c)) % mod
for i in range(len(text) - m + 1):
if th in pattern_hashes:
window = text[i:i + m]
for p in pattern_hashes[th]:
if window == p:
results[p].append(i)
if i < len(text) - m:
th = (base * (th - ord(text[i]) * h) + ord(text[i + m])) % mod
return results
DFA-Based Matching
Goal: search the same fixed pattern against many texts (e.g. millions of FASTQ reads) with O(1) work per character and no fallback logic.
Approach: build a transition table automaton[state][char] where state is how much of the pattern is matched so far; each transition is precomputed once via the KMP prefix trick (prefix_length), so scanning is a simple state-machine walk with no backtracking.
def prefix_length(pattern: str, probe: str) -> int:
"""Longest prefix of pattern that is also a suffix of probe (KMP prefix-function trick)."""
combined = pattern + "#" + probe + "$"
sp = [0] * len(combined)
j = 0
for i in range(1, len(combined) - 1):
while j > 0 and combined[i] != combined[j]:
j = sp[j - 1]
if combined[i] == combined[j]:
j += 1
sp[i] = j
return sp[-2] # value at the char right before the sentinel '$'
def build_automaton(pattern: str, alphabet: str) -> list[dict[str, int]]:
"""Build DFA transition table; state == len(pattern) is the accepting state."""
return [
{c: prefix_length(pattern, pattern[:i] + c) for c in alphabet}
for i in range(len(pattern) + 1)
]
def dfa_search(text: str, automaton: list[dict[str, int]]) -> list[int]:
"""Scan text through the DFA; every char is O(1), no backtracking. Raises KeyError on out-of-alphabet chars."""
accept = len(automaton) - 1
state, matches = 0, []
for i, c in enumerate(text):
state = automaton[state][c]
if state == accept:
matches.append(i - accept + 1)
return matches
alphabet = "ATGC"
pattern = "ATTCTGATTT"
dfa = build_automaton(pattern, alphabet)
hits = dfa_search("AATGCCGTATTCTATTCTGATTTCTGAATTCTGATTTTTAGT", dfa) # -> [13, 27]
Pitfalls
- KMP overlapping matches: after a full match, set
j = f[m-1], notj = 0— otherwise overlapping occurrences likeAAinAAAAare missed. - Rabin-Karp spurious hits: a hash match is not a guarantee; always verify with
text[i:i+m] == pattern. Skip verification only if collision probability is provably negligible. - Rolling hash negative values:
(th - ord(text[i]) * h) % modcan go negative in Python — it wraps correctly, but in C/Java you must addmodbefore taking%. - DFA alphabet completeness: every character in the text must have a transition defined; unrecognized characters raise
KeyError— explicitly handle or restrict to the known alphabet (e.g. treat non-ACGT bases as mismatches). - DFA preprocessing cost: O(m×|Σ|) build time — not worth it for |Σ|=256 (ASCII) with small
m; prefer KMP there. It pays off for small fixed alphabets (DNA, |Σ|=4) reused across many texts. - Naive with
text[i:i+m]: creates a new string object per position (O(m) space each); use explicit char-by-char comparison for truly O(1) space. - KMP
j = -1sentinel: this implementation usesj = -1to signal "no prefix matched, advance without comparing" — don't confuse it with a real array index.
Bioinformatics Connections
| Application | Algorithm | Notes |
|---|---|---|
Restriction site finding (EcoRI: GAATTC) |
KMP or DFA | Single fixed pattern; DFA fast for streaming FASTQ |
| Motif scanning (TFBS, k-mer search) | Rabin-Karp | Hash all motif variants, single text pass |
| BLAST seed-and-extend | Naive | Short seed (11-mer default); large alphabet → fast mismatch |
| Tandem repeat detection | KMP prefix function | sp[i] reveals internal repetition period |
| Multiple restriction enzymes | Rabin-Karp multi | All enzymes same length → one scan |
| Long-read mapping seeds | DFA | Fixed seed pattern, millions of reads |
See Also
graphs-dynamic-programming— edit distance, Smith-Waterman use DP on character gridsadvanced-string-structures— tries, Aho-Corasick, and suffix arrays for many-pattern or all-substring queriesalgo-suffix-arrays— O(n log n) suffix array + Kasai LCP for repeated-motif and k-mer countingalgo-hash-tables-bloom— hash table / Bloom filter internals underlying the Rabin-Karp hash