Version Compatibility
Reference examples tested with: BioPython 1.83+, samtools 1.19+
Before using code patterns, verify installed versions match. If versions differ:
- Python:
pip show <package>thenhelp(module.function)to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Reverse Complement
Generate complementary and reverse complementary sequences using Biopython.
"Get the reverse complement" → Produce the 5'-to-3' sequence of the opposite strand.
- Python:
seq.reverse_complement()(BioPythonSeq) - CLI:
samtools faidx ref.fa region --reverse-complement
Required Import
from Bio.Seq import Seq
Core Methods
reverse_complement()
Returns the reverse complement (5' to 3' of the opposite strand).
seq = Seq('ATGCGATCG')
rc = seq.reverse_complement() # Returns Seq('CGATCGCAT')
This is the most commonly used operation - it gives you the sequence of the opposite strand in the conventional 5' to 3' direction.
complement()
Returns the complement without reversing.
seq = Seq('ATGCGATCG')
comp = seq.complement() # Returns Seq('TACGCTAGC')
Less commonly used - gives the opposite strand but in 3' to 5' direction.
reverse_complement_rna()
For RNA sequences (uses U instead of T):
rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna() # Returns Seq('CGAUCGCAU')
complement_rna()
rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna() # Returns Seq('UACGCUAGC')
Base Pairing Rules
DNA
| Base | Complement |
|---|---|
| A | T |
| T | A |
| G | C |
| C | G |
RNA
| Base | Complement |
|---|---|
| A | U |
| U | A |
| G | C |
| C | G |
Ambiguous Bases (IUPAC)
| Code | Bases | Complement |
|---|---|---|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |
Biopython handles IUPAC ambiguity codes correctly.
Code Patterns
Basic Reverse Complement
seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5'-{seq}-3'')
print(f'RevComp: 5'-{rc}-3'')
Visualize Double-Stranded DNA
def show_dsdna(seq):
comp = seq.complement()
print(f"5'-{seq}-3'")
print(f" {'|' * len(seq)}")
print(f"3'-{comp}-5'")
seq = Seq('ATGCGATCG')
show_dsdna(seq)
Check if Sequence is Palindrome (Self-Complementary)
def is_palindrome(seq):
return seq == seq.reverse_complement()
seq1 = Seq('GAATTC') # EcoRI site - palindrome
seq2 = Seq('ATGCGA') # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')
Reverse Complement a FASTA File
Goal: Produce a new FASTA file with all sequences reverse-complemented.
Approach: Parse records, create new SeqRecords with .reverse_complement(), write to output.
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
def reverse_complement_records(records):
for record in records:
yield SeqRecord(
record.seq.reverse_complement(),
id=record.id + '_rc',
description=record.description + ' reverse complement'
)
records = SeqIO.parse('sequences.fasta', 'fasta')
SeqIO.write(reverse_complement_records(records), 'sequences_rc.fasta', 'fasta')
Primer Design Helper
def design_primer_pair(template, start, end):
'''Design forward and reverse primers for a region'''
forward = template[start:start + 20]
reverse = template[end - 20:end].reverse_complement()
return forward, reverse
template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5'-3'): {fwd}')
print(f'Reverse primer (5'-3'): {rev}')
Handle Both Strands in Analysis
Goal: Search for a motif on both DNA strands.
Approach: Search the forward sequence, then search its reverse complement. Convert positions on the reverse strand back to forward-strand coordinates.
def search_both_strands(seq, motif):
'''Search for a motif on both strands'''
motif = Seq(motif)
results = []
pos = seq.find(motif)
while pos != -1:
results.append(('+', pos))
pos = seq.find(motif, pos + 1)
rc = seq.reverse_complement()
pos = rc.find(motif)
while pos != -1:
results.append(('-', len(seq) - pos - len(motif)))
pos = rc.find(motif, pos + 1)
return results
seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
print(f'Found on {strand} strand at position {pos}')
Common Use Cases
| Task | Method |
|---|---|
| Get opposite strand | reverse_complement() |
| Primer for opposite strand | reverse_complement() of target region |
| Template strand from coding | reverse_complement() |
| Check palindrome | seq == seq.reverse_complement() |
| Search both strands | Search original and reverse_complement |
Common Errors
| Error | Cause | Solution |
|---|---|---|
| Wrong bases in result | Mixing DNA/RNA methods | Use reverse_complement_rna() for RNA |
TypeError |
Passing string instead of Seq | Wrap in Seq() first |
Decision Tree
Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│ └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│ └── Use complement()
├── Working with RNA?
│ └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│ └── seq == seq.reverse_complement()
└── Designing primers?
└── Reverse primer = reverse_complement() of 3' end
Related Skills
- seq-objects - Create Seq objects to complement
- transcription-translation - Six-frame translation uses reverse complement
- motif-search - Search both strands for motifs
- restriction-analysis/restriction-sites - Restriction sites are often palindromic
- alignment-files/sam-bam-basics - BAM FLAG indicates read strand; use samtools view -f 16 for reverse
Converted and distributed by TomeVault — claim your Tome and manage your conversions.