CRISPResso2 Editing Analysis
Basic Analysis
# Analyze single amplicon
CRISPResso \
--fastq_r1 sample_R1.fastq.gz \
--fastq_r2 sample_R2.fastq.gz \
--amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \
--guide_seq CTGCCCACAGGTGAGGAGGT \
--output_folder crispresso_output \
--name sample1
# Output includes:
# - Editing efficiency statistics
# - Indel distribution
# - Allele frequency plots
With HDR Template
# Analyze HDR editing
CRISPResso \
--fastq_r1 hdr_sample_R1.fastq.gz \
--fastq_r2 hdr_sample_R2.fastq.gz \
--amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \
--guide_seq CTGCCCACAGGTGAGGAGGT \
--expected_hdr_amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGATGCTCGGCTGTGGTT \
--output_folder hdr_output \
--name hdr_sample
Batch Analysis
# Create batch file (tab-separated)
# batch.txt:
# name fastq_r1 fastq_r2 amplicon_seq guide_seq
# sample1 s1_R1.fq.gz s1_R2.fq.gz AMPLICON1 GUIDE1
# sample2 s2_R1.fq.gz s2_R2.fq.gz AMPLICON2 GUIDE2
CRISPRessoBatch \
--batch_settings batch.txt \
--output_folder batch_output \
--n_processes 8
Pool Analysis (Multiple Guides)
# Analyze pooled amplicons
CRISPRessoPooled \
--fastq_r1 pooled_R1.fastq.gz \
--fastq_r2 pooled_R2.fastq.gz \
--amplicon_file amplicons.txt \
--output_folder pooled_output \
--n_processes 8
# amplicons.txt format:
# amplicon_name amplicon_seq guide_seq
WGS Analysis
# Analyze off-target editing from WGS
CRISPRessoWGS \
--bam aligned.bam \
--reference genome.fa \
--regions_file targets.bed \
--output_folder wgs_output
Parse Results in Python
import pandas as pd
import json
# Load mapping statistics
with open('crispresso_output/CRISPResso_mapping_statistics.txt') as f:
stats = {}
for line in f:
key, value = line.strip().split('\t')
stats[key] = value
print(f"Reads aligned: {stats['READS_ALIGNED']}")
print(f"Reads aligned %: {stats['READS_ALIGNED_PERCENTAGE']}")
# Load quantification
quant = pd.read_csv('crispresso_output/CRISPResso_quantification_of_editing_frequency.txt', sep='\t')
print(quant)
# Load allele frequency
alleles = pd.read_csv('crispresso_output/Alleles_frequency_table.zip', compression='zip', sep='\t')
print(f"Unique alleles: {len(alleles)}")
print(alleles.head(10))
Key Output Files
CRISPResso_output/
├── CRISPResso_mapping_statistics.txt # Read mapping stats
├── CRISPResso_quantification_of_editing_frequency.txt # Summary
├── Alleles_frequency_table.zip # All allele sequences
├── CRISPResso_RUNNING_LOG.txt # Analysis log
├── Indel_histogram.png # Indel size distribution
├── Insertion_deletion_substitution.png # Edit type pie chart
├── Alleles_frequency_table.png # Top allele bar plot
└── CRISPResso2_info.json # Machine-readable summary
Quantify Specific Outcomes
# Define expected outcomes
CRISPResso \
--fastq_r1 sample_R1.fastq.gz \
--amplicon_seq AMPLICON \
--guide_seq GUIDE \
--coding_seq CODING_REGION \
--quantification_window_size 5 \
--quantification_window_center -3 \
--output_folder output
Base Editing Analysis
# For base editors (CBE/ABE)
CRISPResso \
--fastq_r1 base_edit_R1.fastq.gz \
--amplicon_seq AMPLICON \
--guide_seq GUIDE \
--base_editor_output \
--conversion_nuc_from C \
--conversion_nuc_to T \
--output_folder base_edit_output
Prime Editing Analysis
# For prime editing
CRISPResso \
--fastq_r1 prime_edit_R1.fastq.gz \
--amplicon_seq AMPLICON \
--guide_seq GUIDE \
--prime_editing_pegRNA_spacer_seq SPACER \
--prime_editing_pegRNA_extension_seq EXTENSION \
--prime_editing_pegRNA_scaffold_seq SCAFFOLD \
--output_folder prime_edit_output
Compare Samples
# Compare two CRISPResso runs
CRISPRessoCompare \
--crispresso_output_folder_1 sample1_output \
--crispresso_output_folder_2 sample2_output \
--output_folder comparison_output
Related Skills
- screen-qc - QC for editing experiments
- read-alignment/bwa-alignment - Align reads for WGS analysis
- variant-calling/variant-calling - Detect editing-induced variants