How do I install the Cutadapt skill?

Run npx skillmds@latest add vimalinx/cutadapt in your terminal (requires Node.js), paste this page's agent-chat prompt into Claude, Cursor, or any MCP-connected agent, or download the SKILL.md file and copy it into your agent's skills directory.

Is Cutadapt safe to use?

This skill has not completed SkillMD's automated safety review yet. Independent scanners report: SkillSpector: PASS, Skill Scanner: PASS. Capability flags: docs only, makes network calls. SkillMD never runs a skill's scripts for you; review the SKILL.md before installing.

Which AI agents work with Cutadapt?

This skill is tagged as working with Claude Code, Claude.ai, OpenAI Codex. SKILL.md is an open format, so most agents that read a skills directory can load it too.

Is Cutadapt free to use?

Yes. Installing skills from SkillMD is free, and the skill stays under its author's original license.

Who published Cutadapt?

vimalinx (@vimalinx) published this skill. Their other Agent Skills are listed on their SkillMD profile.

Cutadapt by vimalinx — Agent Skill

Name: Cutadapt
Rating: 4.2 (5 reviews)
Author: vimalinx

Cutadapt

Use when you need to remove adapter sequences from high-throughput sequencing reads, trim low-quality bases, or filter reads by length. Supports single-end and paired-end FASTQ/FASTA input with error-tolerant adapter matching.

vimalinx Updated Aug 19, 2026 0 repo stars

File contents

cutadapt

Quick Start

Command: cutadapt -a ADAPTER -o output.fastq input.fastq
Local executable: /home/vimalinx/miniforge3/envs/bio/bin/cutadapt
Version: 5.2
Full reference: See references/help.md for complete options and documentation

When To Use This Tool

Remove known adapter sequences with explicit 3', 5', or anywhere-end semantics.
Paired-end trimming where read synchronization must be preserved exactly.
Quality trimming and length filtering after or alongside adapter removal.
Prefer cutadapt over fastp when the adapter model itself needs precise control.

Common Patterns

# 1) Trim a known 3' adapter from single-end reads
cutadapt \
  -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
  -o sample.trimmed.fastq.gz \
  sample.fastq.gz

# 2) Paired-end trimming with separate R1/R2 adapters
cutadapt \
  -a ADAPTER_R1 \
  -A ADAPTER_R2 \
  -o sample_R1.trimmed.fastq.gz \
  -p sample_R2.trimmed.fastq.gz \
  sample_R1.fastq.gz sample_R2.fastq.gz

# 3) Adapter trimming plus quality/length filtering
cutadapt \
  -a ADAPTER \
  -q 20 \
  -m 50 \
  --json sample.cutadapt.json \
  -o sample.trimmed.fastq.gz \
  sample.fastq.gz

Recommended Workflow

Determine whether the adapter is expected at the 3' end, 5' end, or either end.
Encode that expectation with -a, -g, or -b rather than using a vague fallback.
Add quality and length filters after the adapter model is correct.
Review the cutadapt report or JSON output before sending reads downstream.

Guardrails

Without -o, reads go to stdout; that is fine for piping, but dangerous if you expected a file.
For paired-end data, always provide both inputs and both outputs so mate synchronization is preserved.
-b/--anywhere is powerful but easy to misuse; do not use it unless you really want 5' or 3' matching.
Use -j to parallelize larger jobs; default execution is single-core.

---name: cutadaptdescription: Use when you need to remove adapter sequences from high-throughput sequencing reads, trim low-quality bases, or filter reads by length. Supports single-end and paired-end FASTQ/FASTA input with error-tolerant adapter matching.---# cutadapt## Quick Start- **Command:** `cutadapt -a ADAPTER -o output.fastq input.fastq`- **Local executable:** `/home/vimalinx/miniforge3/envs/bio/bin/cutadapt`- **Version:** 5.2- **Full reference:** See [references/help.md](references/help.md) for complete options and documentation## When To Use This Tool- Remove known adapter sequences with explicit 3', 5', or anywhere-end semantics.- Paired-end trimming where read synchronization must be preserved exactly.- Quality trimming and length filtering after or alongside adapter removal.- Prefer `cutadapt` over `fastp` when the adapter model itself needs precise control.## Common Patterns```bash# 1) Trim a known 3' adapter from single-end readscutadapt \ -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ -o sample.trimmed.fastq.gz \ sample.fastq.gz``````bash# 2) Paired-end trimming with separate R1/R2 adapterscutadapt \ -a ADAPTER_R1 \ -A ADAPTER_R2 \ -o sample_R1.trimmed.fastq.gz \ -p sample_R2.trimmed.fastq.gz \ sample_R1.fastq.gz sample_R2.fastq.gz``````bash# 3) Adapter trimming plus quality/length filteringcutadapt \ -a ADAPTER \ -q 20 \ -m 50 \ --json sample.cutadapt.json \ -o sample.trimmed.fastq.gz \ sample.fastq.gz```## Recommended Workflow1. Determine whether the adapter is expected at the 3' end, 5' end, or either end.2. Encode that expectation with `-a`, `-g`, or `-b` rather than using a vague fallback.3. Add quality and length filters after the adapter model is correct.4. Review the cutadapt report or JSON output before sending reads downstream.## Guardrails- Without `-o`, reads go to stdout; that is fine for piping, but dangerous if you expected a file.- For paired-end data, always provide both inputs and both outputs so mate synchronization is preserved.- `-b/--anywhere` is powerful but easy to misuse; do not use it unless you really want 5' or 3' matching.- Use `-j` to parallelize larger jobs; default execution is single-core.

Frequently asked questions