Sequence

Sequence

Use this skill when the user supplies a DNA sequence and asks for ORFs, translation, restriction sites, Kozak context, primer checks, local FASTA record matching, or simple bench-style sequence QA.

Contract

• These tools operate only on supplied sequence strings and explicitly supplied local reference FASTA files.
• They do not use active genome context or external services.
• Report deterministic sequence facts directly. Add biological interpretation only when the user supplies enough context or separate source evidence.

Tool Flow

• Use sequence.analyze when more than one deterministic sequence fact may be needed.
• Use sequence.match_reference when a local FASTA can identify the supplied sequence before downstream reasoning.
• Use sequence.translate for frame/strand translation.
• Use sequence.find_orfs for ATG-to-stop ORF discovery.
• Use sequence.find_restriction_sites for common enzymes or custom motifs.
• Use sequence.classify_kozak for ATG start-context checks.
• Use sequence.check_primers for basic GC, Wallace Tm, self-complementarity, and optional template amplicons.

Examples:

• sequence.translate with {"sequence":"ATGGCCATTGTAATGGGCCGCTGA","frame":1}
• sequence.find_orfs with {"sequence":"AAATGAAATAG","min_aa":1}
• sequence.find_restriction_sites with {"sequence":"GAATTCGGATCC","enzymes":["EcoRI","BamHI"]}
• sequence.match_reference with {"sequence":"ATGAAATAA","reference_fasta":"refs.fa"}

Answering

Give the computed result and enough coordinates or frame details to make the answer auditable. Do not turn sequence utility output into medical or personal-genome interpretation.

Cross-Capability Synthesis

A scope-limited result from this capability is not a final user-facing answer when other Genomi capabilities can contribute orthogonal evidence to the same question. Returning "cannot answer" while applicable capabilities remain unexamined is a host-agent failure mode.

Tools

sequence.analyze

Run a compact deterministic sequence analysis bundle and point to focused sequence tools when needed.

Use when: The user supplies DNA/RNA sequence text and may need translation, ORF, motif, Kozak, or local FASTA identity facts.

Why necessary: Supplied DNA strings need deterministic sequence utilities before any biological interpretation.

Example prompts: Translate this DNA sequence and find ORFs.

Result semantics: Computes deterministic sequence facts from supplied text and optional local FASTA reference matches; no external annotation is performed.

sequence.check_primers

Check basic primer properties and optional template amplicons.

Use when: Checks primer GC, melting temperature, self-complementarity, and optional amplicon context.

Why necessary: Primer checks combine basic thermodynamic and amplicon facts that are not variant evidence.

Result semantics: Performs lightweight deterministic primer checks; it does not replace full primer-design thermodynamics.

sequence.classify_kozak

Classify Kozak sequence context around ATG start codons.

Use when: Checks Kozak/start-codon context around a supplied DNA sequence position.

Why necessary: Start-codon context is a specialized expression-design check and should stay separate from general translation.

Result semantics: Uses the simple -3 A/G and +4 G Kozak rule; experimental expression strength needs separate evidence.

sequence.find_orfs

Find ATG-to-stop open reading frames in a supplied DNA sequence.

Use when: Finds open reading frames and coding-sequence candidates in a supplied DNA sequence.

Why necessary: ORF detection identifies candidate coding regions without relying on external annotation.

Result semantics: Finds simple ATG-to-stop ORFs from supplied sequence text; biological annotation requires separate source evidence.

sequence.find_restriction_sites

Find common restriction enzyme or custom motif sites in a supplied DNA sequence.

Use when: Maps restriction enzyme sites and sequence motifs in a supplied DNA sequence.

Why necessary: Cloning and motif checks need exact site positions in the supplied sequence.

Result semantics: Reports motif positions in the supplied sequence; it does not model methylation or digestion conditions.

sequence.match_reference

Match a supplied DNA sequence against local FASTA records and return record identifiers plus annotations.

Use when: The task supplies a DNA sequence and a local FASTA/reference set that can identify the sequence record before downstream reasoning.

Why necessary: Local FASTA matching identifies sequence records before downstream reasoning about that sequence.

Result semantics: Returns exact local FASTA record matches and header annotations; the host agent decides whether a matched record answers the question.

sequence.translate

Translate a DNA sequence in a selected frame and strand using the standard genetic code.

Use when: Translates a supplied DNA sequence into codons or amino acids for the requested frame and strand.

Why necessary: Protein translation requires explicit frame and strand control rather than informal sequence reading.

Result semantics: Computes deterministic sequence facts from the supplied string only; no genome context or external IO is used.