FridrichMethod CRISPR Off-Target Predictor
This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.
When to Use This Skill
- Designing new CRISPR experiments.
- Validating sgRNA specificity before synthesis.
- Analyzing potential safety risks in gene editing protocols.
Core Capabilities
- Mismatch Scoring: Calculates mismatch penalties for potential sites.
- PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
- Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.
Workflow
- Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
- Analysis: Scans a reference library (mocked for this version) for similar sequences.
- Output: List of potential off-targets with locations and risk scores.
Example Usage
User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."
Agent Action:
python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG